Loading...
Images of Vera Hershkovitz
(0 from 0 )Network Profiles
LinkedIn: Vera Hershkovitz - Research Assistant - Sheba - Tel Ha LinkedIn
View Vera Hershkovitz's profile on LinkedIn, the world's largest professional community. Vera has 1 job listed on their profile. See the complete profile on ...
LinkedIn: Vera Hershkovitz | LinkedIn
View Vera Hershkovitz's professional profile on LinkedIn. LinkedIn is the world's largest business network, helping professionals like Vera Hershkovitz discover ...
Interests
New RNA letter regulates gene expression: Discovery brings RNA to the...
www.sciencedaily.com
A new study finds that RNA, considered the DNA template for protein translation, often appears with an extra letter -- and this letter is the regulatory key...
Business Profiles
Researchgate: Vera Hershkovitz
Bet Dagan, Israel
Related Documents
CiteSeerX
citeseerx.ist.psu.edu
BibTeX @MISC{Hershkovitz_, author = {Vera Hershkovitz and Haya Friedman and Eliezer E. Goldschmidt and Edna Pesis}, title = {}, year = {}}
Postharvest unlimited Abstract - PDF Free Download
healthdocbox.com
... of ethylene response-pathway components in avocado ripening Vera Hershkovitz, Haya Friedman, Eliezer E. Goldschmidt, Rosa Ben-Arie, Oleg Feygenberg, ...
Stem cells. m6A mRNA methylation facilitates resolution of naïve ...
www.scienceopen.com
Authors: Shay Geula , Sharon Moshitch-Moshkovitz , Dan Dominissini , Abed AlFatah Mansour , Nitzan Kol , Mali Salmon-Divon , Vera Hershkovitz , Eyal Peer ...
IBS 2012
ibs12.cs.huji.ac.il
Noa Sela, Vera Hershkovitz, Ginat Rafael, Clarita BenDayan, Leena Taha, Michael Wisniewski, Samir Droby; Evidence for Allosteric Efects in Antivodies
Scientific Publications
Postharvest Biology and Technology | Vol 37, Issue 3, Pages
www.sciencedirect.com
Vera Hershkovitz, Sam I. Saguy, Edna Pesis. Pages : Download PDF. Article preview. select article Deterioration of beit alpha and slicing cucumbers ...
The role of the embryo and ethylene in avocado fruit mesocarp...
www.ncbi.nlm.nih.gov
... role of the embryo and ethylene in avocado fruit mesocarp discoloration. Vera Hershkovitz, Haya Friedman, [...], and Edna Pesis. Additional article information ...
Vol. 60, No. 3, of Journal of Experimental Botany on JSTOR
www.jstor.org
The aim of JXB is to publish the highest quality manuscripts that address questions of broad interest in plant biology. We welcome manuscripts that identify...
De-novo assembly and characterization of the transcriptome of...
bmcgenomics.biomedcentral.com
Vera Hershkovitz, Noa Sela contributed equally to this work. Declarations Acknowledgment. This study ... BMC Genomics ISSN: Contact us ...
Publications
- CORE
core.ac.uk
Vera Hershkovitz . By Vera Hershkovitz, Haya Friedman, Eliezer E. Goldschmidt and Edna Pesis. Abstract. This paper is available online free of all access charges (see ...
De-novo assembly and characterization of the transcriptome of...
link.springer.com
Background The yeast Metschnikowia fructicolais an antagonist with biological control activity against postharvest diseases of several fruits. We performed a...
Glycine betaine improves oxidative stress tolerance and biocontrol...
www.biomedsearch.com
Jia Liu; Michael Wisniewski; Samir Droby; Silvana Vero; Shiping Tian; Vera Hershkovitz. Publication Detail: Type: JOURNAL ARTICLE Date: ...
Reports & Statements
The dynamic N 1 -methyladenosine methylome in eukaryotic messenger...
www.nature.com
Here the m1A modification is discovered in messenger RNA and mapped at the transcriptome-wide level; the modification is conserved, dynamic, accumulates in...
Miscellaneous
Vera Hershkovitz | LinkedIn
www.linkedin.com
View Vera Hershkovitz’s professional profile on LinkedIn. LinkedIn is the world's largest business network, helping professionals like Vera Hershkovitz discover ...
Vera Hershkovitz (vhershko) · Benchling
benchling.com
Vera Hershkovitz (vhershko) is doing research with Benchling.
Vera Hershkovitz
pag.confex.com
Vera Hershkovitz. ARO, the Volcani Center P.O. Box 6. Bet-Dagan Israel gov.il. Papers: P0418 Genetic Analysis of Malus ...
Metschnikowia: Hershkovitz, Vera - Expertscape.com
www.expertscape.com
Vera Hershkovitz has special expertise in Metschnikowia
Addgene: pBRPyCAG-Mettl3-dsRed-IRES-puro
www.addgene.org
Plasmid pBRPyCAG-Mettl3-dsRed-IRES-puro from Dr. Jacob Hanna's lab contains the insert Mettl3 and is published in Science 1 January This plasmid is...
Yuan Sui; Jia Liu; Michael Wisniewski; Samir Droby; John Norelli;...
booksc.xyz
Yuan Sui; Jia Liu; Michael Wisniewski; Samir Droby; John Norelli; Vera Hershkovitz: free download. Ebooks library. On-line books store on Z-Library |...
Addgene: px335 Mettl14 sgRNA #1
www.addgene.org
Plasmid px335 Mettl14 sgRNA #1 from Dr. Jacob Hanna's lab contains the insert gcggcagctcctagctcagc and is published in Science 1 January This plasmid is...
Cross Reference Logo Citations to this article as recorded by ...
pubs.rsc.org
... Moshe Shay Ben-Haim, Qing Dai, Ayelet Di Segni, Mali Salmon-Divon, Wesley C. Clark, Guanqun Zheng, Tao Pan, Oz Solomon, Eran Eyal, Vera Hershkovitz, ...
ורה הרשקוביץ
www.myname.org.il
כל המידע ברשת על ורה הרשקוביץ, דוח מידע מלא, מידע גלוי מהרשת, מידע מרשתות חברתיות, רכילות, קטעי וידאו ועוד.
Hershkovitz's Phone Number and Address in Ra'anana - from Israel...
www.israelpb.com
IsraelPB.com has Hershkovitz's phone number in Ra'anana! Israel Phone Book is Israel's only phone directory in English. Find all of your relatives and friends!...
Extra RNA letter found; helps explain epigenetics – Uncommon Descent
uncommondescent.com
... Guanqun Zheng, Tao Pan, Oz Solomon, Eran Eyal, Vera Hershkovitz, Dali Han , Louis C. Doré, Ninette Amariglio, Gideon Rechavi, Chuan He ...
Gen İfadelenmesi Düzenleyicisi Yeni RNA Harfi Keşfedildi »BilimFili.com
bilimfili.com
... Guanqun Zheng, Tao Pan, Oz Solomon, Eran Eyal, Vera Hershkovitz, Dali Han , Louis C. Doré, Ninette Amariglio, Gideon Rechavi, Chuan He ...
ส้ม, ส้มเขียวหวาน, ส้มเกลี้ยง (orange, sweet orange, tangerine),...
www.phtnet.org
Samir Droby, Roni Har-Noy, Ginat Raphael, Vera Hershkovitz, Michael Wisniewski Abstracts of 7th International Postharvest Symposium (IPS2012)
Abstract: Genetic Analysis of Malus sieversii PI for Resistance...
pag.confex.com
Vera Hershkovitz , ARO, the Volcani Center, Bet-Dagan, Israel. C. Thomas Chao , USDA-ARS, Geneva, NY. Blue mold of apple caused by Penicillium expansum ...
Addgene: m6A mRNA methylation facilitates resolution of naïve...
www.addgene.org
Shay Geula, Sharon Moshitch-Moshkovitz, Dan Dominissini, Abed AlFatah Mansour, Nitzan Kol, Mali Salmon-Divon, Vera Hershkovitz, Eyal Peer, Nofar Mor, ...
Glycine betaine improves oxidative stress tolerance and biocontrol...
www.infona.pl
... the antagonistic yeast Cystofilobasidium infirmominiatum. more. less. Jia Liu, Michael Wisniewski, Samir Droby, Silvana Vero, Shiping Tian, Vera Hershkovitz.
Effect of seed on ripening control components during avocado fruit...
www.infona.pl
Seedless avocado fruit are produced alongside seeded fruit in the cultivar Arad, and both reach maturity at the same time. Using this system, it was...
m6A mRNA methylation facilitates resolution of naïve pluripotency...
mdanderson.elsevierpure.com
Shay Geula ; Sharon Moshitch-Moshkovitz ; Dan Dominissini ; Abed AlFatah Mansour ; Nitzan Kol ; Mali Salmon-Divon ; Vera Hershkovitz ; Eyal Peer ; Nofar Mor ; Yair S ...
Effect of heat treatment on inhibition of Monilinia fructicola and...
www.infona.pl
Vera Hershkovitz. Agricultural Research Organization (ARO), The Volcani Center, P.O. Box 6, Bet Dagan , Israel. Terms of service ...
Induction of ethylene in avocado fruit in response to chilling stress...
www.infona.pl
Twórcy. autor. Vera Hershkovitz. The Robert H. Smith Faculty of Agriculture, Food and Environment, The Hebrew University of Jerusalem, Rehovot , Israel ...
Related search requests for Vera Hershkovitz
| Haya Friedman Samir Droby Shay Geula | Michael Wisniewski |
People Forename "Vera" (15391) Name "Hershkovitz" (64) |
sorted by relevance / date