1
0
0
News
Segment | Tout Le Monde En Parle | ICI Radio-Canada.ca
ici.radio-canada.ca
Visitez le site web de cette émission incontournable où Guy A. Lepage, Dany Turcotte et leurs invités discutent de politique, de culture et de sports.
«Il faut ouvrir la boîte noire du génome des blés» - Libération
www.liberation.fr
Un consortium s’est lancé en dans le séquençage du blé cultivé. Selon Catherine Feuillet, une de ses directrices, ce projet permettrait de diversifier le...
Guardian: Scientists sequence wheat genome in breakthrough once thought ...theguardian.com
A co-author of the article and chief scientist with Inari Agriculture in the US, Dr Catherine Feuillet, said the achievement would have immediate ...
Catherine Feuillet, directrice de recherche Inra, distinguée par la...
agriavis.com
Catherine Feuillet, sélectionnée dans la section « Agriculture, Alimentation et Ressources Renouvelables », est la seule scientifique française ...
Telephone & Addresses
Catherine Feuillet, Bethesda, US, Wyoming Rd
View Catherine's social profiles and photos on Facebook, MySpace, and +40 Networks.
Interests
Catherine Feuillet-Denis Video Game Credits and Biography - MobyGames
www.mobygames.com
Catherine Feuillet-Denis has been credited on games developed by the following companies: White Birds Productions. This does not imply employment by these...
BREEDWHEAT: 39 M€ ($55m USD) Secured in France for Long-Term Wheat...
www.prweb.com
... USD) grant for the BREEDWHEAT project, a long-term public-private research initiative coordinated by Catherine Feuillet from INRA-GDEC.
Business Profiles
Catherine Feuillet - Chief Scientific Officer - Inari | ZoomInfo.comwww.zoominfo.com › Catherine-Feuillet
www.zoominfo.com
View Catherine Feuillet's business profile as Chief Scientific Officer at Inari. Find contact's direct phone number, email address, work history, and more.
Catherine Feuillet | GMO Answersgmoanswers.com › experts › catherine-feuillet
gmoanswers.com
Catherine Feuillet was the Head of trait research at Bayer since July Until then, she was a research director and leader of the group, “Structure, function ...
Private Homepages
PAG XXII Newsletter // Attendee Issue: #10 January
myemail.constantcontact.com
(L to R - Alexandre Caetano, Gerard Lazo, Graham Moore, Catherine Feuillet, Dave Clements (2015 Committee Member), Hans Cheng, David ...
Employees
Catherine Feuillet - Chief Scientific Officer at Inari | The Orgtheorg.com › org › inari › team › catherine-feuillet
theorg.com
Catherine brings deep experience in research innovation and extensive knowledge of genomics and wheat. Prior to Inari, she worked at Bayer CropScience ...
Education
Catherine FEUILLET (CAMUS), 43 ans (SAINT PIERRE , MOURMELON LE...
copainsdavant.linternaute.com
FEUILLET (CAMUS) Catherine : Catherine FEUILLET (CAMUS), née en Aux dernières nouvelles il était à Collège Henri Guillaumet à MOURMELON LE ...
Catherine FEUILLET, 46 ans (CHARMOY, PROVINS) - Copains d'avant
copainsdavant.linternaute.com
FEUILLET Catherine : Catherine FEUILLET, née en et habite CHARMOY. Aux dernières nouvelles elle était à Centre Hospitalier Léon Binet à PROVINS et elle y...
Celebrities & Politicians
IMDB Filmography: Catherine Feuillet
Self, Tout le monde en parle
Heritage
Feuillet Genealogy | WikiTree FREE Family Treewikitree.com
www.wikitree.com
Pierre Feuillet abt Catherine Feuillet 20 Aug Reuilly, 36 Indre, France last edited 23 May Jean Feuillet 10 Nov Paudy, 36 Indre, France.
Projects
3BSeq - WHEAT URGIwheat-urgi.versailles.inra.fr › Projects › Achieved-projects
wheat-urgi.versailles.inra.fr
Aug 11, · Coordinator: Catherine Feuillet. Partner 1 : INRA GDEC (Clermont-Ferrand). Frédéric Choulet, Etienne Paux, Pierre Sourdille, Philippe Leroy, ...
IWGSC - WHEAT URGIwheat-urgi.versailles.inra.fr › Projects › IWGSC
wheat-urgi.versailles.inra.fr
Aug 21, · ... State University), Kellye Eversole (Eversole Associates), Catherine Feuillet ( Inari Ag), Beat Keller (University of Zurich), Etienne Paux (INRA), ...
Books & Literature
Catherine Feuillet & Gary J. Muehlbauer: Genetics and Genomics of the Triticeae (ebook/PC-PDF)
2009, Sciences, Biology, Botany, ISBN:
Genetics and Genomics of the Triticeae / Edition 1 by Catherine...
www.barnesandnoble.com
Available in: Hardcover. Sequencing of the model plant genomes such as those of A. thaliana and rice has revolutionized our understanding of plant
bokus.com: Genetics and Genomics of the Triticeae - Catherine Feuillet, Gary J...
Köp Genetics and Genomics of the Triticeae av Catherine Feuillet, Gary J Muehlbauer. Skickas inom vardagar. Fri frakt över 159 kr. Välkommen till Bokus...
Genetics And Genomics Of The Triticeae, Book by Catherine Feuillet...
www.chapters.indigo.ca
Buy the Paperback Book Genetics And Genomics Of The Triticeae by Catherine Feuillet at Indigo.ca, Canada's largest bookstore. + Get Free Shipping on Science...
Related Documents
The wheat genome sequence: a foundation for accelerating improvment o…
www.slideshare.net
ACTTGTGCATAGCATGCAATGCCATATATAGCAGTCTGCTAAGTCTATAG The wheat genomeCAGACCCTCAACGTGGATCATCCGT sequence: a foundationAGCTAGCCATGACATTGATCCTGATTTACACCATGTA…
Agriculture: Feeding the future
ui.adsabs.harvard.edu
AM(Catherine Feuillet Institut National de la Recherche Agronomique (INRA), Clermont-Ferrand, France.), AN(Paul Gepts and Jeffrey Ross-Ibarra University of ...
File:Fr-Catherine Feuillet.ogg - Wikimedia Commons
commons.wikimedia.org
This file is made available under the Creative Commons CC Universal Public Domain Dedication. The person who associated a work with ...
Ancient haplotypes resulting from extensive molecular ...genome.cshlp.org › content › 526.abstract
genome.cshlp.org
Edwige Isidore1,4,; Beatrice Scherrer1,4,; Boulos Chalhoub2,; Catherine Feuillet 1,3, and; Beat Keller1,5. + Author Affiliations. 1 Institute of Plant Biology, ...
Scientific Publications
Organization and evolution of transposable elements along the ...pubmed.ncbi.nlm.nih.gov › ...
pubmed.ncbi.nlm.nih.gov
... Véronique Jamilloux, Etienne Paux, Valérie Barbe, Sophie Mangenot, Adriana Alberti, Patrick Wincker, Hadi Quesneville, Catherine Feuillet, Frédéric Choulet.
Molecular Evolution of Receptor-Like Kinase Genes in NCBI - NIHwww.ncbi.nlm.nih.gov › pmc › articles › PMC65610
www.ncbi.nlm.nih.gov
Independent Evolution of Orthologs after Polyploidization and Mechanisms of Local Rearrangements at Paralogous Loci. Catherine Feuillet, Anja Penger, Klaus ...
A high density physical map of chromosome 1BL supports evolutionary...
genomebiology.biomedcentral.com
As for other major crops, achieving a complete wheat genome sequence is essential for the application of genomics to breeding new and improved varieties. To...
dblp: Catherine Feuillet
dblp1.uni-trier.de
List of computer science publications by Catherine Feuillet
Publications
Publications Authored by Catherine Feuillet | PubFacts.com
www.pubfacts.com
Catherine Feuillet - Institute of Plant Biology. Follow Catherine Feuillet. Catherine Feuillet. Are you Catherine Feuillet? Claim your profile, edit publications, add ...
Genetics and Genomics of the Triticeae | Catherine Feuillet | Springerwww.springer.com › book
link.springer.com
Edited by Catherine Feuillet and Gary Muehlbauer. Domestication of cereals in the Fertile Crescent 10,000 years ago ushered in the beginning of agriculture, ...
Catherine Feuillet - theses.frwww.theses.fr › ...
www.theses.fr
L' annotation des éléments transposables par la compréhension de leur diversification. par Timothée Flutre sous la direction de Catherine Feuillet et de Hadi ...
Video & Audio
Itw de Mme Catherine FEUILLET sur Orange Vidéosvideo-streaming.orange.fr
video-streaming.orange.fr
▶ 1:07Interview de Madame Catherine FEUILLET, chargée d'affaires àl'ambassade de France de Lisbonne.
YouTube
www.youtube.com
Catherine Feuillet, arrivée cet automne au Consulat de Montréal, a une feuille de route chargée, entre modernisation du consulat, préparation des échéances é...
Itw de Mme Catherine FEUILLET - Vidéo Dailymotionwww.dailymotion.com › video
www.dailymotion.com
Sep 7, · Interview de Madame Catherine FEUILLET, chargée d'affaires àl'ambassade de France de ...Duration: 1:07Posted: Sep 7, 2015
Catherine Feuillet: Next generation wheat genome sequencing ...www.youtube.com › watch
www.youtube.com
Nov 18, · Catherine Feuillet presenting 'A next generation wheat genome sequence for next generation ...Duration: 51:55Posted: Nov 18, 2019
Reports & Statements
Google Groups: postdoc in functional genomics
: Dr. Catherine Feuillet Institute of Plant Biology University of Zurich Zollikerstr.107 CH Zurich Switzerland =46ax: Email: ...
Google Groups: Alerte Google - solidarité-niger
: Google Alertes xCtrl === Alerte Google Web : solidarité-niger === Solidarite Niger - Atelier Peinture Catherine Feuillet ...
Google Groups: ITMI Workshop Announcement!
: ... by an international committee (Catherine Feuillet--U of Zurich, SWITERLAND; John Fellers--USDA, ARS, Kansas State U, USA; Mike Gale--John Innes Centre, ...
Wikipedia: Catherine Feuillet - Wikipediaen.wikipedia.org › wiki › Catherine_Feuillet
Catherine Feuillet (French pronunciation: [katʁin fœjɛ] ( listen); born July 1965) is a French geneticist who is currently the Chief Scientific Officer of Inari Agriculture, a Cambridge MA based biotechnology company.
Education and early life · Past research and awards · Wheat genome sequencingAwards: Prix Foulon, Trophée de la Femme, Chevalier of the Legion of Honour, Jean Dufrenoy Prize from the Académie d'Agricul...
Nationality: French
Miscellaneous
Catherine Feuillet | LinkedIn
www.linkedin.com
View Catherine Feuillet's professional profile on LinkedIn. LinkedIn is the world's largest business network, helping professionals like Catherine Feuillet discover ...
Catherine Feuillet at Bayer CropScience | LinkedIn
www.linkedin.com
Head of Trait Research at Bayer CropScience View Catherine’s full profile Leader of the group "Structure, function and Evolution of the Wheat Genome" at the INRA -Clermont -Ferrand (UMR Genetics, DIversity and Ecophysiology of Cereals).
Catherine Feuillet - Chief Scientific Officer - Inari Agriculture | LinkedInlinkedin.com
www.linkedin.com
Catherine Feuillet’s Activity CAMBRIDGE, Mass., Aug. 6, PRNewswire/ -- Inari, the next-generation seed company, today Leader of the group "Structure, function and Evolution of the Wheat Genome" at the INRA -Clermont -Ferrand (UMR Genetics, DIversity and Ecophysiology ...
Societe.com : RCS, siret, siren, bilan, l'information gratuite sur...
www.societe.com
CATHERINE FEUILLET : identité (INSEE), solvabilité, outils de veille.
Catherine Feuillet - Nominations au Journal officiel de la République ...jorfsearch.steinertriples.fr
jorfsearch.steinertriples.fr
De: Catherine Feuillet. (Suppléant), DR1, Inra. Objet: Membre du jury de concours de directeur de recherche de 1ère classe de l'Institut national de la recherche ...
Catherine Feuillet - Zaidi-STEM : Zaidi-STEMzaidistem.org › our-team › catherine-feuillet
zaidistem.org
Catherine Feuillet. Advisory Board. Catherine has over twenty years' experience in research innovation and extensive knowledge in genomics and ...
Catherine Feuillet / Coordinating members / Users - IWGSCwww.wheatgenome.org › layout › set › print › Users › Catherine-Feuillet
www.wheatgenome.org
Catherine Feuillet. Organization / Company: Inari. Counrty: United States. Address: Cambridge, MA. .
Catherine Feuillet Biography, Age, Height, Husband, Net Worth, Family
www.celebsagewiki.com
Catherine Feuillet was born on 1 July, in Orléans, France, is a French geneticist. Discover Catherine Feuillet's Biography, Age, Height, Physical Stats,...
Catherine Feuillet - téléphone et adresse - annuaire annuaire fr
annuaire.118712.fr
Il existe 8 Catherine Feuillet en France métropolitaine et dans les DOM répertoriés dans l'annuaire La majorité des Catherine Feuillet habite dans le ...
Catherine Feuillet High Resolution Stock Photography and Images ...www.alamy.com › stock-photo › catherine-feuillet
www.alamy.com
Find the perfect catherine feuillet stock photo. Huge collection, amazing choice, 100+ million high quality, affordable RF and RM images. No need to register, ...
Catherine Feuillet, directrice de recherche à l'INRA sur la génomique...
www.ogm.org
Catherine Feuillet, directrice de recherche à l'INRA sur la génomique du blé livre son témoignage sur ses recherches sur la génomique du blé à l'INRA
Catherine Feuillet WGSC co-founder | Simanaitis Sayssimanaitissays.com › tag › catherine-feuillet-wgsc-co-founder
simanaitissays.com
Aug 29, · Posts about Catherine Feuillet WGSC co-founder written by simanaitissays.
Catherine Feuillet | B·DEBATEwww.bdebate.org › speaker › catherine-feuillet
www.bdebate.org
Keyword. Search. Home; Catherine Feuillet. Catherine Feuillet. PDF icon CV. Catherine Feuillet. France. Institut National de la Recherche Agronomique (INRA ) ...
Catherine Feuillet | Olivier Cadicoliviercadic.com
www.oliviercadic.com
(à l'image) Entre Marion Dehais, consule générale adjointe et Catherine Feuillet, consule générale. Je suis très reconnaissant à leur égard de ...
Catherine Feuillet | Revolvyrevolvy.com
www.revolvy.com
Catherine Feuillet (French pronunciation: (listen); born July 1965) is a French geneticist who is the head of trait research at Bayer CropScience and a co-chair of ...
Catherine Feuillet – AVANT GARDE @ CIRANOavantgarde.cirano.qc.ca › speaker › catherine-feuillet
avantgarde.cirano.qc.ca
Vice-President of the SKEMA Global Lab in Augmented Intelligence. In a career spanning almost 30 years, Catherine Feuillet has held various positions within ...
Catherine Feuillet – Europlantbiology - plant biology europeeuroplantbiology2020.org › session_speaker › catherine-feuillet
europlantbiology2020.org
Catherine Feuillet received her PhD in plant biotechnology in followed by 10 years of postdoctoral studies and as assistant professor at the University of ...
Visite de Mme Catherine Feuillet, Consule générale - Collège...
www.cimf.ca
Conseillère des affaires étrangères hors classe (Orient), Mme Catherine Feuillet a été nommée Consule générale de France à Montréal par ...
Catherine Feuillet, le nouveau visage de la diplomatie française à ...loutardeliberee.com › catherine-feuillet-le-nouveau-vis...
loutardeliberee.com
Oct 26, · Catherine Feuillet a une feuille de route bien chargée. Outre la modernisation des services consulaires et la fin de la double comparution pour ...
Dr Catherine Feuillet Dassonval, Allergologue à Puteaux, Boulogne ...www.doctolib.fr › Doctolib › Allergologue › Hauts-de-Seine › Puteaux
www.doctolib.fr
Prenez RDV en ligne avec Dr Catherine Feuillet Dassonval: Allergologue, Conventionné secteur 1. Adresse : 26 Rue Anatole France, Puteaux.
Related search requests for Catherine Feuillet
| Beat Keller Robbie Waugh Etienne Paux |
Person "Feuillet" (1) Forename "Catherine" (40879) Name "Feuillet" (120) |
sorted by relevance / date